Answer
$(a)$ (5')CGACGGCGCGAAGUCAGGGGUGUUAAG(3')
$(b)$ Arg-Arg-Glu-Val-Arg-Gly-Val-Lys
$(c)$ No.
Work Step by Step
(a) (5')CGACGGCGCGAAGUCAGGGGUGUUAAG(3')
(b) Arg-Arg-Glu-Val-Arg-Gly-Val-Lys
(c) No, the complementary anti parallel stands in double-helical DNA do not have the same base sequence in the 5'to 3' direction. the rna is transcribed from only one specific strand of duplex DNA. The RNA polymerase must therefore recognize and bind the the correct strand.
